New England Biolabs Canada

NEBuffer Activity/Performance Chart with Restriction Enzymes

We have exciting news! We have transitioned our restriction enzymes into a new buffer system in order to make your restriction digests even more convenient for you. This latest improvement involves the addition of BSA, as well as the removal of DTT. By adding BSA to the buffer, we are now able to offer >200 enzymes that cut in a single buffer. This improves ease-of-use, especially when performing double digests. It also eliminates the need to add BSA separately. NEBuffers 1, 2 and 3 have been replaced by NEBuffers 1.1, 2.1 and 3.1, respectively. NEBuffer 4 has been replaced with CutSmart Buffer. Please note that the old buffers are still available. Detailed information on the new buffer system, along with an extensive list of FAQs, can be found at NEBCutSmart.com.

The Activity/Performance now contains information on the new buffer system. However, we understand that many customers will still have enzymes that were provided with the old buffer system and will thus still need to reference this information. The old NEBuffer Activity Chart is available on each RE product page. You can also receive additional support by contacting info@neb.com.

Legend

Not Sensitive   Impaired
Blocked Impaired by Overlapping
Blocked by Overlapping Impaired by Some Combinations of Overlapping
Blocked by Some Combinations of Overlapping

Please check out other technical reference information related to restriction enzymes:
Double Digestion | Heat Inactivation | Activity at 37°C | Diluent Buffers | Time-Saver Enzymes | High Fidelity (HF) Restriction Enzymes 

Chart Legend | Icon Descriptions

    Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent Dam Dcm CpG Unit Substrate Note
    1.1 2.1 3.1 CutSmart
    AatII  recombinant timesaver 5min cpg GACGT/C CutSmart™ Buffer 10 50* 50 100 80°C 37°C Not Sensitive Not Sensitive Blocked λ DNA
    AbaSI  recombinant NEBuffer 4 25 50 50 100 65°C 25°C Not Sensitive Not Sensitive Not Sensitive e
    Acc65I  recombinant timesaver 5min dcm cpg G/GTACC NEBuffer 3.1 10 75* 100 25 65°C 37°C Not Sensitive Blocked by Some Combinations of Overlapping Blocked by Some Combinations of Overlapping pBC4 DNA
    AccI  recombinant timesaver 5min cpg GT/MKAC CutSmart™ Buffer 50 50 10 100 80°C 37°C Not Sensitive Not Sensitive Blocked by Overlapping λ DNA
    AciI  recombinant timesaver 5min cpg CCGC(-3/-1) CutSmart™ Buffer 10 25 100 100 65°C 37°C Not Sensitive Not Sensitive Blocked λ DNA
    AclI  recombinant timesaver 5min cpg AA/CGTT CutSmart™ Buffer 10 10 10 100 No 37°C Not Sensitive Not Sensitive Blocked λ DNA
    AcuI  recombinant timesaver 5min CTGAAG(16/14) CutSmart™ Buffer + SAM 50 100 50 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA 3, b, d
    AfeI  recombinant cpg AGC/GCT CutSmart™ Buffer 25 100 25 100 65°C 37°C Not Sensitive Not Sensitive Blocked pXba DNA
    AflII  recombinant timesaver 5min C/TTAAG CutSmart™ Buffer 50 100 10 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive ΦX174 RF I DNA
    AflIII  recombinant A/CRYGT NEBuffer 3.1 10 50 100 50 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    AgeI  recombinant cpg A/CCGGT NEBuffer 1.1 100 75 25 75 65°C 37°C Not Sensitive Not Sensitive Blocked λ DNA 2
    AgeI-HF  recombinant timesaver 5min engineered cpg A/CCGGT CutSmart™ Buffer 100 50 10 100 65°C 37°C Not Sensitive Not Sensitive Blocked λ DNA
    AgeI-HF® RE-Mix®  recombinant timesaver 5min engineered re-mix icon cpg A/CCGGT - - - - - 65°C 37°C - Not Sensitive Not Sensitive Blocked
    AhdI  recombinant timesaver 5min cpg GACNNN/NNGTC CutSmart™ Buffer 25 25 10 100 65°C 37°C Not Sensitive Not Sensitive Impaired by Some Combinations of Overlapping λ DNA a
    AleI  recombinant cpg CACNN/NNGTG CutSmart™ Buffer 10 10 10 100 80°C 37°C Not Sensitive Not Sensitive Impaired by Some Combinations of Overlapping λ DNA
    AluI  recombinant timesaver 5min AG/CT CutSmart™ Buffer 25 100 50 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA b
    AlwI  recombinant dam GGATC(4/5) CutSmart™ Buffer 50 50 10 100 No 37°C Blocked Not Sensitive Not Sensitive λ DNA (dam-) 1, b, d
    AlwNI  recombinant timesaver 5min dcm CAGNNN/CTG CutSmart™ Buffer 10 100 50 100 80°C 37°C Not Sensitive Blocked by Overlapping Not Sensitive λ DNA
    ApaI  recombinant timesaver 5min dcm cpg GGGCC/C CutSmart™ Buffer 25 25 10 100 65°C 25°C Not Sensitive Blocked by Overlapping Blocked by Overlapping pXba DNA
    ApaLI  recombinant timesaver 5min cpg G/TGCAC CutSmart™ Buffer 100 100 10 100 No 37°C Not Sensitive Not Sensitive Blocked by Overlapping λ DNA (HindIII digest)
    ApeKI  recombinant timesaver 5min cpg G/CWGC NEBuffer 3.1 25 50 100 10 No 75°C Not Sensitive Not Sensitive λ DNA
    ApoI  recombinant timesaver 5min R/AATTY NEBuffer 3.1 10 75 100 75 80°C 50°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    AscI  recombinant timesaver 5min cpg GG/CGCGCC CutSmart™ Buffer 10 10 10 100 80°C 37°C Not Sensitive Not Sensitive Blocked λ DNA
    AscI RE-Mix®  recombinant timesaver 5min re-mix icon cpg GG/CGCGCC - - - - - 65°C 37°C - Not Sensitive Not Sensitive Blocked
    AseI  recombinant timesaver 5min AT/TAAT NEBuffer 3.1 10 50* 100 10 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA 3
    AsiSI  recombinant cpg GCGAT/CGC CutSmart™ Buffer 50 100 100 100 80°C 37°C Not Sensitive Not Sensitive Blocked XhoI digested pXba 2, b
    AvaI  recombinant timesaver 5min cpg C/YCGRG CutSmart™ Buffer 10 100 25 100 80°C 37°C Not Sensitive Not Sensitive Blocked λ DNA
    AvaII  recombinant timesaver 5min dcm cpg G/GWCC CutSmart™ Buffer 50 75 10 100 80°C 37°C Not Sensitive Blocked by Overlapping Blocked by Overlapping λ DNA
    AvrII  recombinant timesaver 5min C/CTAGG CutSmart™ Buffer 100 50 50 100 No 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA (HindIII digest)
    BaeGI  timesaver 5min GKGCM/C NEBuffer 3.1 75 75 100 25 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    BaeI  timesaver 5min cpg (10/15)ACNNNNGTAYC(12/7) CutSmart™ Buffer + SAM 50 100 50 100 65°C 25°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping pXba DNA e
    BamHI  recombinant timesaver 5min G/GATCC NEBuffer 3.1 75* 100* 100 100* No 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA 3
    BamHI-HF®  recombinant timesaver 5min engineered G/GATCC CutSmart™ Buffer 100 50 10 100 No 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    BanI  recombinant dcm cpg G/GYRCC CutSmart™ Buffer 10 25 10 100 65°C 37°C Not Sensitive Blocked by Some Combinations of Overlapping Blocked by Some Combinations of Overlapping λ DNA 1
    BanII  recombinant GRGCY/C CutSmart™ Buffer 100 100 50 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA 2
    BbsI  timesaver 5min GAAGAC(2/6) NEBuffer 2.1 100 100 25 N/R 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    BbvCI  recombinant cpg CCTCAGC(-5/-2) CutSmart™ Buffer 10 100 50 100 No 37°C Not Sensitive Not Sensitive Impaired by Overlapping λ DNA 1, a
    BbvI  recombinant timesaver 5min GCAGC(8/12) CutSmart™ Buffer 100 100 25 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive pBR322 (dcm+) DNA 3
    BccI  recombinant CCATC(4/5) CutSmart™ Buffer 100 50 10 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive pXba DNA 3, b
    BceAI  recombinant cpg ACGGC(12/14) NEBuffer 3.1 100* 100* 100 100* 65°C 37°C Not Sensitive Not Sensitive Blocked pBR322 (dcm+) DNA 1
    BcgI  recombinant dam cpg (10/12)CGANNNNNNTGC(12/10) NEBuffer 3.1 + SAM 10 75* 100 50* 65°C 37°C Impaired by Overlapping Not Sensitive Blocked by Some Combinations of Overlapping λ DNA e
    BciVI  recombinant timesaver 5min GTATCC(6/5) CutSmart™ Buffer 100 25 10 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA b
    BclI  recombinant timesaver 5min dam T/GATCA NEBuffer 3.1 50 100 100 75 No 50°C Blocked Not Sensitive Not Sensitive λ DNA (dam-)
    BcoDI  recombinant timesaver 5min cpg GTCTC(1/5) CutSmart™ Buffer 50 75 75 100 No 37°C Not Sensitive Not Sensitive Impaired by Some Combinations of Overlapping λ DNA
    BfaI C/TAG CutSmart™ Buffer 10 10 10 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA 2, b
    BfuAI  timesaver 5min cpg ACCTGC(4/8) NEBuffer 3.1 10 25 100 10 65°C 50°C Not Sensitive Not Sensitive Impaired by Overlapping λ DNA 3
    BfuCI  timesaver 5min cpg /GATC CutSmart™ Buffer 100 50 25 100 80°C 37°C Not Sensitive Not Sensitive Blocked by Overlapping λ DNA
    BglI  recombinant timesaver 5min cpg GCCNNNN/NGGC NEBuffer 3.1 10 25 100 10 65°C 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA
    BglII  recombinant timesaver 5min A/GATCT NEBuffer 3.1 10 10 100 10 No 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    BlpI  recombinant timesaver 5min GC/TNAGC CutSmart™ Buffer 50 100 10 100 No 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA d
    BmgBI  recombinant timesaver 5min cpg CACGTC(-3/-3) NEBuffer 3.1 10 10 100 10 65°C 37°C Not Sensitive Not Sensitive Blocked λ DNA 3, b, d
    BmrI  recombinant ACTGGG(5/4) NEBuffer 2.1 75 100 75 100* 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA (HindIII digest) b
    BmtI  recombinant GCTAG/C NEBuffer 3.1 100 100 100 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive pXba DNA 2
    BmtI-HF®  recombinant timesaver 5min engineered GCTAG/C CutSmart™ Buffer 50 100 10 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive pXba DNA
    BpmI  recombinant CTGGAG(16/14) NEBuffer 3.1 75 100 100 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA 2
    Bpu10I  recombinant CCTNAGC(-5/-2) NEBuffer 3.1 10 25 100 25 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA 3, b, d
    BpuEI  recombinant timesaver 5min CTTGAG(16/14) CutSmart™ Buffer + SAM 50* 100 50* 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA d
    BsaAI  recombinant timesaver 5min cpg YAC/GTR CutSmart™ Buffer 100 100 100 100 No 37°C Not Sensitive Not Sensitive Blocked λ DNA
    BsaBI  dam cpg GATNN/NNATC CutSmart™ Buffer 50 100 75 100 80°C 60°C Blocked by Overlapping Not Sensitive Blocked by Some Combinations of Overlapping λ DNA (dam-) 2
    BsaHI  recombinant timesaver 5min dcm cpg GR/CGYC CutSmart™ Buffer 50 100 100 100 80°C 37°C Not Sensitive Blocked by Some Combinations of Overlapping Blocked λ DNA
    BsaI  recombinant dcm cpg GGTCTC(1/5) CutSmart™ Buffer 75* 75 100 100 65°C 37°C Not Sensitive Blocked by Overlapping Blocked by Some Combinations of Overlapping pXba DNA 3
    BsaI-HF®  recombinant timesaver 5min engineered dcm cpg GGTCTC(1/5) CutSmart™ Buffer 50 100 25 100 65°C 37°C Not Sensitive Blocked by Overlapping Blocked by Some Combinations of Overlapping pXba DNA
    BsaJI  recombinant C/CNNGG CutSmart™ Buffer 50 100 100 100 80°C 60°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    BsaWI  recombinant timesaver 5min W/CCGGW CutSmart™ Buffer 10 100 50 100 80°C 60°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    BsaXI  timesaver 5min (9/12)ACNNNNNCTCC(10/7) CutSmart™ Buffer 50* 100* 10 100 No 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA e
    BseRI  recombinant timesaver 5min GAGGAG(10/8) CutSmart™ Buffer 100* 100 75 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA d
    BseYI  recombinant cpg CCCAGC(-5/-1) NEBuffer 3.1 10 50 100 50 80°C 37°C Not Sensitive Not Sensitive Blocked by Overlapping λ DNA d
    BsgI  recombinant timesaver 5min GTGCAG(16/14) CutSmart™ Buffer + SAM 25 50 25 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA d
    BsiEI  timesaver 5min cpg CGRY/CG CutSmart™ Buffer 25 50 10 100 80°C 60°C Not Sensitive Not Sensitive Blocked λ DNA
    BsiHKAI GWGCW/C CutSmart™ Buffer 25 100 100 100 No 65°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    BsiWI  recombinant timesaver 5min cpg C/GTACG NEBuffer 3.1 25 50* 100 25 65°C 55°C Not Sensitive Not Sensitive Blocked ΦX174 DNA
    BslI  recombinant timesaver 5min dcm cpg CCNNNNN/NNGG CutSmart™ Buffer 50 75 100 100 No 55°C Not Sensitive Blocked by Some Combinations of Overlapping Blocked by Some Combinations of Overlapping λ DNA b
    BsmAI  recombinant timesaver 5min cpg GTCTC(1/5) CutSmart™ Buffer 50 100 100 100 No 55°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA
    BsmBI  recombinant timesaver 5min cpg CGTCTC(1/5) NEBuffer 3.1 10 50* 100 25 80°C 55°C Not Sensitive Not Sensitive Blocked λ DNA
    BsmFI  recombinant dcm cpg GGGAC(10/14) CutSmart™ Buffer 25 50 50 100 80°C 65°C Not Sensitive Blocked by Overlapping Blocked by Overlapping pBR322 (dcm+) DNA 1
    BsmI  recombinant timesaver 5min GAATGC(1/-1) CutSmart™ Buffer 25 100 10 100 80°C 65°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    BsoBI  recombinant timesaver 5min C/YCGRG CutSmart™ Buffer 25 100 100 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    Bsp1286I  recombinant timesaver 5min GDGCH/C CutSmart™ Buffer 25 25 25 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA 3
    BspCNI  recombinant timesaver 5min CTCAG(9/7) CutSmart™ Buffer + SAM 100 75 10 100 80°C 25°C Not Sensitive Not Sensitive Not Sensitive λ DNA b
    BspDI  recombinant dam cpg AT/CGAT CutSmart™ Buffer 25 75 50 100 80°C 37°C Blocked by Overlapping Not Sensitive Blocked λ DNA
    BspEI  recombinant timesaver 5min dam cpg T/CCGGA NEBuffer 3.1 10 10 100 10 80°C 37°C Blocked by Overlapping Not Sensitive Impaired λ DNA (dam-)
    BspHI  recombinant timesaver 5min dam T/CATGA CutSmart™ Buffer 10 50 25 100 80°C 37°C Blocked by Overlapping Not Sensitive Not Sensitive λ DNA
    BspMI  recombinant ACCTGC(4/8) NEBuffer 3.1 10 50* 100 10 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    BspQI  recombinant timesaver 5min GCTCTTC(1/4) NEBuffer 3.1 100 100 100 100 80°C 50°C Not Sensitive Not Sensitive Not Sensitive λ DNA 3
    BsrBI  timesaver 5min cpg CCGCTC(-3/-3) CutSmart™ Buffer 50 100 100 100 80°C 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA d
    BsrDI  timesaver 5min GCAATG(2/0) NEBuffer 2.1 10 100 75 25 80°C 65°C Not Sensitive Not Sensitive Not Sensitive λ DNA 3, d
    BsrFI  recombinant cpg R/CCGGY CutSmart™ Buffer 10 100* 100* 100 No 37°C Not Sensitive Not Sensitive Blocked pBR322 (dcm+) DNA 1
    BsrGI  recombinant timesaver 5min T/GTACA NEBuffer 2.1 25 100 100 25 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    BsrI  timesaver 5min ACTGG(1/-1) NEBuffer 3.1 10 50 100 10 80°C 65°C Not Sensitive Not Sensitive Not Sensitive ΦX174 RF I DNA b
    BssHII  recombinant timesaver 5min cpg G/CGCGC CutSmart™ Buffer 100 100 100 100 65°C 50°C Not Sensitive Not Sensitive Blocked λ DNA
    BssKI  recombinant timesaver 5min dcm cpg /CCNGG CutSmart™ Buffer 50 100 100 100 80°C 60°C Not Sensitive Blocked by Overlapping Blocked by Overlapping λ DNA b
    BssSI  recombinant CACGAG(-5/-1) NEBuffer 3.1 50 100 100 50 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    BstAPI  recombinant cpg GCANNNN/NTGC CutSmart™ Buffer 50 100 25 100 80°C 60°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA b
    BstBI  recombinant timesaver 5min cpg TT/CGAA CutSmart™ Buffer 75 100 10 100 No 65°C Not Sensitive Not Sensitive Blocked λ DNA
    BstEII   recombinant timesaver 5min G/GTNACC NEBuffer 3.1 10 75* 100 75* No 60°C Not Sensitive Not Sensitive Not Sensitive λ DNA 3
    BstEII-HF®  recombinant timesaver 5min engineered G/GTNACC CutSmart™ Buffer 10 10 10 100 No 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    BstEII-HF® RE-Mix®  recombinant timesaver 5min engineered re-mix icon G/GTNACC - - - - - No 37°C - Not Sensitive Not Sensitive Not Sensitive
    BstNI  recombinant timesaver 5min CC/WGG NEBuffer 3.1 10 100 100 75 No 60°C Not Sensitive Not Sensitive Not Sensitive λ DNA a
    BstUI  timesaver 5min cpg CG/CG CutSmart™ Buffer 50 100 25 100 No 60°C Not Sensitive Not Sensitive Blocked λ DNA b
    BstXI  recombinant timesaver 5min dcm CCANNNNN/NTGG NEBuffer 3.1 10 50 100 25 80°C 37°C Not Sensitive Blocked by Some Combinations of Overlapping Not Sensitive λ DNA 3
    BstYI  recombinant timesaver 5min R/GATCY NEBuffer 2.1 25 100 75 100 No 60°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    BstZ17I  timesaver 5min cpg GTA/TAC CutSmart™ Buffer 75 100 100 100 No 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA 3, b
    Bsu36I  recombinant timesaver 5min CC/TNAGG CutSmart™ Buffer 25 100 100 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA (HindIII digest) b
    BtgI  recombinant timesaver 5min C/CRYGG CutSmart™ Buffer 50 100 100 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive pBR322 (dcm+) DNA
    BtgZI  recombinant cpg GCGATG(10/14) CutSmart™ Buffer 10 25 10 100 80°C 60°C Not Sensitive Not Sensitive Impaired λ DNA 3, b, d
    BtsCI  recombinant timesaver 5min GGATG(2/0) CutSmart™ Buffer 10 100 25 100 80°C 50°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    BtsI  recombinant GCAGTG(2/0) CutSmart™ Buffer 100 50 50 100 80°C 55°C Not Sensitive Not Sensitive Not Sensitive λ DNA 1, b
    BtsIMutI  recombinant CAGTG(2/0) CutSmart™ Buffer 100 50 10 100 80°C 55°C Not Sensitive Not Sensitive Not Sensitive pUC19 DNA b
    Cac8I  timesaver 5min cpg GCN/NGC CutSmart™ Buffer 50 75 100 100 65°C 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA b
    ClaI  recombinant timesaver 5min dam cpg AT/CGAT CutSmart™ Buffer 10 50 50 100 65°C 37°C Blocked by Overlapping Not Sensitive Blocked λ DNA (dam-)
    CspCI  recombinant timesaver 5min (11/13)CAANNNNNGTGG(12/10) CutSmart™ Buffer + SAM 10 100 10 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA e
    CviAII  recombinant timesaver 5min C/ATG CutSmart™ Buffer 50 50 10 100 65°C 25°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    CviKI-1  recombinant RG/CY CutSmart™ Buffer 25 100 100 100 No 37°C Not Sensitive Not Sensitive Not Sensitive pBR322 (dcm+) DNA 1, b
    CviQI  recombinant timesaver 5min G/TAC NEBuffer 3.1 75 100* 100 75* No 25°C Not Sensitive Not Sensitive Not Sensitive λ DNA b
    DdeI  recombinant timesaver 5min C/TNAG CutSmart™ Buffer 75 100 100 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    DpnI  recombinant timesaver 5min cpg GA/TC CutSmart™ Buffer 100 100 75 100 80°C 37°C Not Sensitive Not Sensitive Blocked by Overlapping pBR322 DNA (dam methylated) b
    DpnII  recombinant timesaver 5min dam /GATC NEBuffer DpnII 25 25 100* 25 65°C 37°C Blocked Not Sensitive Not Sensitive λ DNA (dam-)
    DraI  recombinant timesaver 5min TTT/AAA CutSmart™ Buffer 75 75 50 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    DraIII  recombinant cpg CACNNN/GTG NEBuffer 3 + BSA 25 50 100 25 65°C 37°C Not Sensitive Not Sensitive Impaired by Overlapping λ DNA
    DraIII-HF®  recombinant timesaver 5min engineered cpg CACNNN/GTG CutSmart™ Buffer 10 50 10 100 No 37°C Not Sensitive Not Sensitive Impaired by Overlapping λ DNA b
    DrdI  timesaver 5min cpg GACNNNN/NNGTC CutSmart™ Buffer 25 50 10 100 65°C 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping pUC19 DNA 3
    DvuIII CACNCAC - N/R N/R N/R N/R No
    EaeI  recombinant dcm cpg Y/GGCCR CutSmart™ Buffer 10 50 10 100 65°C 37°C Not Sensitive Blocked by Overlapping Blocked by Overlapping λ DNA b
    EagI  recombinant timesaver 5min cpg C/GGCCG NEBuffer 3.1 10 25 100 10 65°C 37°C Not Sensitive Not Sensitive Blocked pXba DNA
    EagI-HF®  recombinant timesaver 5min engineered cpg C/GGCCG CutSmart™ Buffer 25 100 100 100 65°C 37°C Not Sensitive Not Sensitive Blocked pXba DNA
    EarI  recombinant timesaver 5min cpg CTCTTC(1/4) CutSmart™ Buffer 50 10 10 100 65°C 37°C Not Sensitive Not Sensitive Impaired by Overlapping λ DNA b, d
    EciI  recombinant cpg GGCGGA(11/9) CutSmart™ Buffer 100 50 50 100 65°C 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA 2
    Eco53kI  recombinant timesaver 5min cpg GAG/CTC CutSmart™ Buffer 100 100 10 100 65°C 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping pXba DNA 3, b
    EcoNI  recombinant timesaver 5min CCTNN/NNNAGG CutSmart™ Buffer 50 100 75 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA b
    EcoO109I  recombinant timesaver 5min dcm RG/GNCCY CutSmart™ Buffer 50 100 50 100 65°C 37°C Not Sensitive Blocked by Overlapping Not Sensitive λ DNA (HindIII digest) 3
    EcoP15I  recombinant timesaver 5min CAGCAG(25/27) NEBuffer 3.1 + ATP 75 100 100 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive pUC19 DNA e
    EcoRI  recombinant timesaver 5min cpg G/AATTC NEBuffer EcoRI 25 100* 50 50* 65°C 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA
    EcoRI-HF®  recombinant timesaver 5min engineered cpg G/AATTC CutSmart™ Buffer 10 100 10 100 65°C 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA
    EcoRI-HF® RE-Mix®  recombinant timesaver 5min engineered re-mix icon cpg G/AATTC - - - - - 65°C 37°C - Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    EcoRV  recombinant timesaver 5min cpg GAT/ATC NEBuffer 3.1 10 50 100 10 80°C 37°C Not Sensitive Not Sensitive Impaired by Some Combinations of Overlapping λ DNA
    EcoRV-HF®  recombinant timesaver 5min engineered cpg GAT/ATC CutSmart™ Buffer 25 100 100 100 65°C 37°C Not Sensitive Not Sensitive Impaired by Some Combinations of Overlapping λ DNA
    EcoRV-HF® RE-Mix®  recombinant timesaver 5min engineered re-mix icon cpg GAT/ATC - - - - - 65°C 37°C - Not Sensitive Not Sensitive Impaired by Some Combinations of Overlapping
    FatI  recombinant /CATG NEBuffer 2.1 10 100 50 50 80°C 55°C Not Sensitive Not Sensitive Not Sensitive pUC19 DNA
    FauI  recombinant cpg CCCGC(4/6) CutSmart™ Buffer 100 50 10 100 65°C 55°C Not Sensitive Not Sensitive Blocked λ DNA 3, b, d
    Fnu4HI  recombinant timesaver 5min cpg GC/NGC CutSmart™ Buffer 10 10 10 100 No 37°C Not Sensitive Not Sensitive Blocked by Overlapping λ DNA a
    FokI  recombinant dcm cpg GGATG(9/13) CutSmart™ Buffer 100 100 75 100 65°C 37°C Not Sensitive Impaired by Overlapping Impaired by Overlapping λ DNA 3, b, d
    FseI  recombinant timesaver 5min dcm cpg GGCCGG/CC CutSmart™ Buffer 100 75 10 100 65°C 37°C Not Sensitive Impaired by Some Combinations of Overlapping Blocked Adenovirus-2 DNA
    FspEI  recombinant CC(12/16) NEBuffer 4 + BSA 10 10 10 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive pBR322 (dcm+) DNA 2, e
    FspI  recombinant timesaver 5min cpg TGC/GCA CutSmart™ Buffer 10 100 10 100 No 37°C Not Sensitive Not Sensitive Blocked λ DNA b
    HaeII  recombinant timesaver 5min cpg RGCGC/Y CutSmart™ Buffer 25 100 10 100 80°C 37°C Not Sensitive Not Sensitive Blocked λ DNA
    HaeIII  recombinant timesaver 5min GG/CC CutSmart™ Buffer 50 100 25 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    HgaI  recombinant cpg GACGC(5/10) NEBuffer 1.1 100 100 25 100 65°C 37°C Not Sensitive Not Sensitive Blocked ΦX174 DNA 1
    HhaI  recombinant timesaver 5min cpg GCG/C CutSmart™ Buffer 25 100 100 100 65°C 37°C Not Sensitive Not Sensitive Blocked λ DNA
    HincII  recombinant timesaver 5min cpg GTY/RAC NEBuffer 3.1 25 100 100 100 65°C 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA
    HindIII  recombinant A/AGCTT NEBuffer 2.1 25 100 50 50 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA 2
    HindIII-HF®  recombinant timesaver 5min engineered A/AGCTT CutSmart™ Buffer 10 100 10 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    HinfI  recombinant timesaver 5min cpg G/ANTC CutSmart™ Buffer 50 100 100 100 80°C 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA
    HinP1I  recombinant timesaver 5min cpg G/CGC CutSmart™ Buffer 100 100 100 100 65°C 37°C Not Sensitive Not Sensitive Blocked λ DNA
    HpaI  recombinant cpg GTT/AAC CutSmart™ Buffer 10 75* 25 100 No 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA 1
    HpaII  recombinant timesaver 5min cpg C/CGG CutSmart™ Buffer 100 50 10 100 80°C 37°C Not Sensitive Not Sensitive Blocked λ DNA
    HphI  recombinant timesaver 5min dam GGTGA(8/7) CutSmart™ Buffer 50 50 10 100 65°C 37°C Blocked by Overlapping Not Sensitive Not Sensitive λ DNA b, d
    Hpy166II  recombinant timesaver 5min cpg GTN/NAC CutSmart™ Buffer 100 100 50 100 65°C 37°C Not Sensitive Not Sensitive Blocked by Overlapping pBR322 DNA
    Hpy188I  recombinant dam TCN/GA CutSmart™ Buffer 25 100 50 100 65°C 37°C Blocked by Some Combinations of Overlapping Not Sensitive Not Sensitive pBR322 (dcm+) DNA 1, b
    Hpy188III  recombinant dam cpg TC/NNGA CutSmart™ Buffer 100 100 10 100 65°C 37°C Blocked by Overlapping Not Sensitive Blocked by Overlapping pUC19 DNA
    Hpy99I  recombinant cpg CGWCG/ CutSmart™ Buffer 50 10 10 100 65°C 37°C Not Sensitive Not Sensitive Blocked λ DNA
    HpyAV  recombinant timesaver 5min cpg CCTTC(6/5) CutSmart™ Buffer 100 100 25 100 65°C 37°C Not Sensitive Not Sensitive Impaired by Overlapping λ DNA
    HpyCH4III  recombinant ACN/GT CutSmart™ Buffer 100 25 10 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    HpyCH4IV  recombinant timesaver 5min cpg A/CGT CutSmart™ Buffer 100 50 25 100 65°C 37°C Not Sensitive Not Sensitive Blocked pUC19 DNA
    HpyCH4V  recombinant timesaver 5min TG/CA CutSmart™ Buffer 50 50 25 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    I-CeuI  recombinant TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) CutSmart™ Buffer 10 10 10 100 65°C 37°C pBHS ScaI-linearized Control Plasmid
    I-SceI  recombinant TAGGGATAACAGGGTAAT(-9/-13) CutSmart™ Buffer 10 50 25 100 65°C 37°C pGPS2 NotI-linearized Control Plasmid
    KasI  recombinant cpg G/GCGCC CutSmart™ Buffer 50 100 50 100 65°C 37°C Not Sensitive Not Sensitive Blocked pBR322 DNA
    KpnI  recombinant GGTAC/C NEBuffer 1.1 100 75 10 50* No 37°C Not Sensitive Not Sensitive Not Sensitive Adenovirus-2 DNA
    KpnI-HF®  recombinant timesaver 5min engineered GGTAC/C CutSmart™ Buffer 100 25 10 100 No 37°C Not Sensitive Not Sensitive Not Sensitive pXba DNA
    KpnI-HF® RE-Mix®  recombinant timesaver 5min engineered re-mix icon GGTAC/C - - - - - No 37°C - Not Sensitive Not Sensitive Not Sensitive
    LpnPI  recombinant CCDG(10/14) NEBuffer 4 + BSA 10 10 10 50 65°C 37°C Not Sensitive Not Sensitive Not Sensitive pBR322 (dcm+) DNA
    MboI  recombinant timesaver 5min dam cpg /GATC CutSmart™ Buffer 75 100 100 100 65°C 37°C Blocked Not Sensitive Impaired by Overlapping λ DNA (dam-)
    MboII  recombinant dam GAAGA(8/7) CutSmart™ Buffer 100* 100 50 100 65°C 37°C Blocked by Overlapping Not Sensitive Not Sensitive λ DNA (dam-)
    MfeI  recombinant C/AATTG CutSmart™ Buffer 75 50 10 100 No 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    MfeI-HF®  recombinant timesaver 5min engineered C/AATTG CutSmart™ Buffer 75 25 10 100 No 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    MfeI-HF® RE-Mix®  recombinant timesaver 5min engineered re-mix icon C/AATTG - - - - - 65°C 37°C - Not Sensitive Not Sensitive Not Sensitive
    MluCI  recombinant timesaver 5min /AATT CutSmart™ Buffer 100 10 10 100 No 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    MluI  recombinant timesaver 5min cpg A/CGCGT NEBuffer 3.1 10 50 100 25 80°C 37°C Not Sensitive Not Sensitive Blocked λ DNA
    MlyI  recombinant timesaver 5min GAGTC(5/5) CutSmart™ Buffer 50 50 10 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    MmeI  recombinant timesaver 5min cpg TCCRAC(20/18) CutSmart™ Buffer + SAM 50 100 50 100 65°C 37°C Not Sensitive Not Sensitive Blocked by Overlapping ΦX174 DNA
    MnlI  recombinant timesaver 5min CCTC(7/6) CutSmart™ Buffer 75 100 50 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    MscI  recombinant dcm TGG/CCA CutSmart™ Buffer 25 100 100 100 80°C 37°C Not Sensitive Blocked by Overlapping Not Sensitive λ DNA
    MseI  recombinant timesaver 5min T/TAA CutSmart™ Buffer 75 100 75 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    MslI  recombinant timesaver 5min CAYNN/NNRTG CutSmart™ Buffer 50 50 10 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    MspA1I  recombinant timesaver 5min cpg CMG/CKG CutSmart™ Buffer 10 50 10 100 65°C 37°C Not Sensitive Not Sensitive Blocked by Overlapping λ DNA
    MspI  recombinant timesaver 5min C/CGG CutSmart™ Buffer 75 100 50 100 No 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    MspJI  recombinant CNNR(9/13) NEBuffer 4 + BSA 10 10 10 50 65°C 37°C Not Sensitive Not Sensitive Not Sensitive pBR322 (dcm+) DNA
    MwoI  recombinant timesaver 5min cpg GCNNNNN/NNGC CutSmart™ Buffer 10 100 100 100 No 60°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA
    NaeI  recombinant cpg GCC/GGC CutSmart™ Buffer 25 25 10 100 No 37°C Not Sensitive Not Sensitive Blocked pXba DNA
    NarI  recombinant cpg GG/CGCC CutSmart™ Buffer 100 100 10 100 65°C 37°C Not Sensitive Not Sensitive Blocked pXba DNA
    Nb.BbvCI  recombinant CCTCAGC CutSmart™ Buffer 25 100 100 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive supercoiled plasmid DNA
    Nb.BsmI  recombinant GAATGC NEBuffer 3.1 10 50 100 10 80°C 65°C Not Sensitive Not Sensitive Not Sensitive pBR322 DNA
    Nb.BsrDI  recombinant GCAATG CutSmart™ Buffer 25 100 100 100 80°C 65°C Not Sensitive Not Sensitive Not Sensitive pUC19 DNA
    Nb.BtsI  recombinant GCAGTG CutSmart™ Buffer 75 100 75 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive ΦX174 DNA
    NciI  recombinant timesaver 5min cpg CC/SGG CutSmart™ Buffer 100 25 10 100 No 37°C Not Sensitive Not Sensitive Impaired by Overlapping λ DNA
    NcoI  recombinant timesaver 5min C/CATGG NEBuffer 3.1 100 100 100 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    NcoI-HF®  recombinant timesaver 5min engineered C/CATGG CutSmart™ Buffer 50 100 10 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    NcoI-HF® RE-Mix®  recombinant timesaver 5min engineered re-mix icon C/CATGG - - - - - 80°C 37°C - Not Sensitive Not Sensitive Not Sensitive
    NdeI  recombinant timesaver 5min CA/TATG CutSmart™ Buffer 75 100 100 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive
    NgoMIV  recombinant timesaver 5min cpg G/CCGGC CutSmart™ Buffer 100 50 10 100 No 37°C Not Sensitive Not Sensitive Blocked Adenovirus-2 DNA
    NheI  recombinant timesaver 5min cpg G/CTAGC NEBuffer 2.1 100 100 10 100 65°C 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA (HindIII digest)
    NheI-HF®  recombinant timesaver 5min engineered cpg G/CTAGC CutSmart™ Buffer 100 25 10 100 80°C 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA (HindIII digest)
    NheI-HF® RE-Mix®  recombinant timesaver 5min engineered re-mix icon cpg G/CTAGC - - - - - 80°C 37°C - Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping
    NlaIII  recombinant timesaver 5min CATG/ CutSmart™ Buffer 10 10 10 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive ΦX174 DNA
    NlaIV  recombinant dcm cpg GGN/NCC CutSmart™ Buffer 10 10 10 100 65°C 37°C Not Sensitive Blocked by Overlapping Blocked by Overlapping
    NmeAIII  recombinant GCCGAG(21/19) CutSmart™ Buffer + SAM 10 10 10 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive ΦX174 RF I DNA
    NotI  recombinant timesaver 5min cpg GC/GGCCGC NEBuffer 3.1 10 50 100 25 65°C 37°C Not Sensitive Not Sensitive Blocked pBC4 DNA
    NotI-HF®  recombinant timesaver 5min engineered cpg GC/GGCCGC CutSmart™ Buffer 25 100 25 100 65°C 37°C Not Sensitive Not Sensitive Blocked pBC4 DNA
    NotI-HF® RE-Mix®   recombinant timesaver 5min engineered re-mix icon cpg GC/GGCCGC - - - - - 65°C 37°C - Not Sensitive Not Sensitive Blocked
    NruI  recombinant timesaver 5min dam cpg TCG/CGA NEBuffer 3.1 10 10 100 10 No 37°C Blocked by Overlapping Not Sensitive Blocked λ DNA
    NsiI  recombinant timesaver 5min ATGCA/T NEBuffer 3.1 10 75 100 25 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    NspI  recombinant timesaver 5min RCATG/Y CutSmart™ Buffer 100 100 10 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    Nt.AlwI  recombinant dam GGATC(4/-5) CutSmart™ Buffer 10 100 100 100 80°C 37°C Blocked Not Sensitive Not Sensitive pUC101 DNA (dam-/dcm-)
    Nt.BbvCI  recombinant cpg CCTCAGC(-5/-7) CutSmart™ Buffer 50 100 10 100 80°C 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping supercoiled plasmid DNA
    Nt.BsmAI  recombinant cpg GTCTC(1/-5) CutSmart™ Buffer 100 50 10 100 65°C 37°C Not Sensitive Not Sensitive Blocked supercoiled plasmid DNA
    Nt.BspQI  recombinant GCTCTTC(1/-7) NEBuffer 3.1 10 25 100 10 80°C 50°C Not Sensitive Not Sensitive Not Sensitive pUC19 DNA
    Nt.BstNBI  recombinant GAGTC(4/-5) NEBuffer 3.1 0 10 100 10 80°C 55°C Not Sensitive Not Sensitive Not Sensitive T7 DNA
    Nt.CviPII  recombinant cpg (0/-1)CCD CutSmart™ Buffer 10 100 25 100 65°C 37°C Not Sensitive Not Sensitive Blocked pUC19 DNA
    PacI  recombinant timesaver 5min TTAAT/TAA CutSmart™ Buffer 100 75 10 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive pNEB193 DNA
    PacI RE-Mix®  recombinant timesaver 5min re-mix icon TTAAT/TAA - - - - - 65°C 37°C - Not Sensitive Not Sensitive Not Sensitive
    PaeR7I  recombinant timesaver 5min cpg C/TCGAG CutSmart™ Buffer 25 100 10 100 No 37°C Not Sensitive Not Sensitive Blocked λ DNA (HindIII digest)
    PciI  recombinant A/CATGT NEBuffer 3.1 50 75 100 50* 80°C 37°C Not Sensitive Not Sensitive Not Sensitive pXba DNA
    PflFI  timesaver 5min GACN/NNGTC CutSmart™ Buffer 25 100 25 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive pBC4 DNA
    PflMI  recombinant timesaver 5min dcm CCANNNN/NTGG NEBuffer 3.1 0 100 100 50 65°C 37°C Not Sensitive Blocked by Overlapping Not Sensitive λ DNA
    PhoI  recombinant dcm cpg GG/CC CutSmart™ Buffer 50 50 100 100 No 75°C Not Sensitive Impaired by Some Combinations of Overlapping Impaired by Some Combinations of Overlapping λ DNA
    PI-PspI  recombinant TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) NEBuffer PI-PspI + BSA 10 10 10 10 No 65°C pAKR7 XmnI-linearized Control Plasmid
    PI-SceI  recombinant ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) NEBuffer PI-SceI + BSA 10 10 10 10 65°C 37°C pBSvdeX XmnI-linearized Control Plasmid
    PleI  recombinant cpg GAGTC(4/5) CutSmart™ Buffer 25 50 25 100 65°C 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA
    PluTI  recombinant cpg GGCGC/C CutSmart™ Buffer 100 25 10 100 65°C 37°C Not Sensitive Not Sensitive Blocked pXba DNA
    PmeI  recombinant timesaver 5min cpg GTTT/AAAC CutSmart™ Buffer 10 50 10 100 65°C 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA
    PmlI  timesaver 5min cpg CAC/GTG CutSmart™ Buffer 100 50 10 100 65°C 37°C Not Sensitive Not Sensitive Blocked λ DNA (HindIII digest)
    PpuMI  recombinant timesaver 5min dcm RG/GWCCY CutSmart™ Buffer 10 10 10 100 No 37°C Not Sensitive Blocked by Overlapping Not Sensitive λ DNA (HindIII digest)
    PshAI  recombinant timesaver 5min cpg GACNN/NNGTC CutSmart™ Buffer 25 50 10 100 65°C 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA
    PsiI  recombinant TTA/TAA CutSmart™ Buffer 10 100 10 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    PspGI  recombinant dcm /CCWGG CutSmart™ Buffer 25 100 50 100 No 75°C Not Sensitive Blocked Not Sensitive T7 DNA
    PspOMI  recombinant dcm cpg G/GGCCC CutSmart™ Buffer 10 10 10 100 65°C 37°C Not Sensitive Impaired by Some Combinations of Overlapping Blocked by Overlapping pXba DNA
    PspXI  recombinant cpg VC/TCGAGB CutSmart™ Buffer 10 100 25 100 No 37°C Not Sensitive Not Sensitive Impaired λ DNA (HindIII digest)
    PstI  recombinant timesaver 5min CTGCA/G NEBuffer 3.1 75 75 100 50* 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    PstI-HF®  recombinant timesaver 5min engineered CTGCA/G CutSmart™ Buffer 10 75 50 100 No 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    PvuI  recombinant timesaver 5min cpg CGAT/CG NEBuffer 3.1 10 25 100 10 No 37°C Not Sensitive Not Sensitive Blocked pXba DNA
    PvuI-HF®  recombinant timesaver 5min engineered cpg CGAT/CG CutSmart™ Buffer 25 100 100 100 No 37°C Not Sensitive Not Sensitive Blocked pXba DNA
    PvuII  recombinant timesaver 5min CAG/CTG NEBuffer 3.1 50 100 100 100* No 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    PvuII-HF®  recombinant timesaver 5min engineered CAG/CTG CutSmart™ Buffer 10 10 10 100 No 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    RsaI  recombinant timesaver 5min cpg GT/AC CutSmart™ Buffer 25 50 10 100 No 37°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA
    RsrII  recombinant cpg CG/GWCCG CutSmart™ Buffer 25 75 10 100 65°C 37°C Not Sensitive Not Sensitive Blocked λ DNA
    SacI  recombinant timesaver 5min GAGCT/C NEBuffer 1.1 100 50 10 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA (HindIII digest)
    SacI-HF®  recombinant timesaver 5min engineered GAGCT/C CutSmart™ Buffer 10 50 10 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA (HindIII digest)
    SacII  recombinant timesaver 5min cpg CCGC/GG CutSmart™ Buffer 10 100 10 100 65°C 37°C Not Sensitive Not Sensitive Blocked pXba DNA
    SalI  recombinant timesaver 5min cpg G/TCGAC NEBuffer 3.1 10 10 100 10 65°C 37°C Not Sensitive Not Sensitive Blocked λ DNA (HindIII digest)
    SalI-HF®  recombinant timesaver 5min engineered cpg G/TCGAC CutSmart™ Buffer 10 100 100 100 65°C 37°C Not Sensitive Not Sensitive Blocked λ DNA (HindIII digest)
    SalI-HF® RE-Mix®  recombinant timesaver 5min engineered re-mix icon cpg G/TCGAC - - - - - 80°C 37°C - Not Sensitive Not Sensitive Blocked
    SapI  recombinant timesaver 5min GCTCTTC(1/4) CutSmart™ Buffer 75 50 10 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    Sau3AI  recombinant cpg /GATC NEBuffer 1.1 100 50 10 100 65°C 37°C Not Sensitive Not Sensitive Blocked by Overlapping λ DNA
    Sau96I  recombinant dcm cpg G/GNCC CutSmart™ Buffer 50 100 100 100 65°C 37°C Not Sensitive Blocked by Overlapping Blocked by Overlapping λ DNA
    SbfI  recombinant timesaver 5min CCTGCA/GG CutSmart™ Buffer 50 25 10 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    SbfI-HF®  recombinant timesaver 5min engineered CCTGCA/GG CutSmart™ Buffer 50 25 10 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    ScaI  recombinant AGT/ACT NEBuffer 3 N/R N/R 100 N/R 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    ScaI-HF®  recombinant timesaver 5min engineered AGT/ACT CutSmart™ Buffer 100 100 10 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    ScaI-HF® RE-Mix®  recombinant timesaver 5min engineered re-mix icon AGT/ACT - - - - - 65°C 37°C - Not Sensitive Not Sensitive Not Sensitive
    ScrFI  recombinant dcm cpg CC/NGG CutSmart™ Buffer 100 100 100 100 65°C 37°C Not Sensitive Blocked by Overlapping Blocked by Overlapping λ DNA
    SexAI  recombinant dcm A/CCWGGT CutSmart™ Buffer 100 75 50 100 65°C 37°C Not Sensitive Blocked Not Sensitive pBC4 DNA (dcm-)
    SfaNI  recombinant cpg GCATC(5/9) NEBuffer 3.1 10 75 100 25 65°C 37°C Not Sensitive Not Sensitive Impaired by Some Combinations of Overlapping ΦX174 RF I DNA
    SfcI  recombinant C/TRYAG CutSmart™ Buffer 75 50 25 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    SfiI  recombinant timesaver 5min dcm cpg GGCCNNNN/NGGCC CutSmart™ Buffer 25 100 50 100 No 50°C Not Sensitive Impaired by Overlapping Blocked by Some Combinations of Overlapping Adenovirus-2 DNA
    SfoI  recombinant timesaver 5min cpg dcm GGC/GCC CutSmart™ Buffer 50 100 100 100 No 37°C Not Sensitive Blocked by Some Combinations of Overlapping Blocked λ DNA (HindIII digest)
    SgrAI  recombinant cpg CR/CCGGYG CutSmart™ Buffer 100 100 10 100 65°C 37°C Not Sensitive Not Sensitive Blocked λ DNA
    SmaI  recombinant timesaver 5min cpg CCC/GGG CutSmart™ Buffer 10 10 10 100 65°C 25°C Not Sensitive Not Sensitive Blocked λ DNA (HindIII digest)
    SmlI  recombinant C/TYRAG CutSmart™ Buffer 25 75 25 100 No 55°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    SnaBI  recombinant cpg TAC/GTA CutSmart™ Buffer 50* 50 10 100 80°C 37°C Not Sensitive Not Sensitive Blocked T7 DNA
    SpeI  recombinant timesaver 5min A/CTAGT CutSmart™ Buffer 75 100 25 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive Adenovirus-2 DNA
    SpeI RE-Mix®  recombinant timesaver 5min re-mix icon A/CTAGT - - - - - 80°C 37°C - Not Sensitive Not Sensitive Not Sensitive
    SpeI-HF®  recombinant timesaver 5min engineered A/CTAGT CutSmart™ Buffer 25 50 10 100 80°C 37°C Not Sensitive Not Sensitive Not Sensitive pXba DNA
    SphI-HF®  recombinant timesaver 5min engineered GCATG/C CutSmart™ Buffer 50 25 10 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    SphI  recombinant GCATG/C NEBuffer 2.1 100 100 50 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    SspI  recombinant timesaver 5min AAT/ATT NEBuffer SspI 50 100 50 50 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    SspI-HF®  recombinant timesaver 5min engineered AAT/ATT CutSmart™ Buffer 25 100 10 100 No 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    StuI  recombinant timesaver 5min dcm AGG/CCT CutSmart™ Buffer 50 100 50 100 No 37°C Not Sensitive Blocked by Overlapping Not Sensitive λ DNA
    StyD4I  recombinant timesaver 5min dcm cpg /CCNGG CutSmart™ Buffer 10 100 100 100 65°C 37°C Not Sensitive Blocked by Overlapping Impaired by Overlapping λ DNA
    StyI  recombinant timesaver 5min C/CWWGG NEBuffer 3.1 10 25 100 10 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    StyI-HF®  recombinant timesaver 5min engineered C/CWWGG CutSmart™ Buffer 25 100 25 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    SwaI  recombinant timesaver 5min ATTT/AAAT NEBuffer 3.1 10 10 100 10 65°C 25°C Not Sensitive Not Sensitive Not Sensitive M13mp19 RF I DNA
    TaqαI  recombinant timesaver 5min dam T/CGA CutSmart™ Buffer 50 75 100 100 80°C 65°C Blocked by Overlapping Not Sensitive Not Sensitive λ DNA
    TfiI  recombinant timesaver 5min cpg G/AWTC CutSmart™ Buffer 50 100 100 100 No 65°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA
    TliI  recombinant cpg C/TCGAG NEBuffer 3 + BSA 10 50 100 50 No 75°C Not Sensitive Not Sensitive Impaired λ DNA (HindIII digest)
    TseI  timesaver 5min cpg G/CWGC CutSmart™ Buffer 75 100 100 100 No 65°C Not Sensitive Not Sensitive Blocked by Some Combinations of Overlapping λ DNA
    Tsp45I /GTSAC CutSmart™ Buffer 100 50 10 100 No 65°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    Tsp509I /AATT NEBuffer 1 N/R N/R N/R N/R No 65°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    TspMI  timesaver 5min cpg C/CCGGG CutSmart™ Buffer 50* 75* 50* 100 No 75°C Not Sensitive Not Sensitive Blocked pUCAdeno plasmid DNA
    TspRI  recombinant timesaver 5min NNCASTGNN/ CutSmart™ Buffer 25 50 25 100 No 65°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    Tth111I  recombinant timesaver 5min GACN/NNGTC CutSmart™ Buffer 25 100 25 100 No 65°C Not Sensitive Not Sensitive Not Sensitive pBC4 DNA
    XbaI  recombinant timesaver 5min dam T/CTAGA CutSmart™ Buffer 10 100 75 100 65°C 37°C Blocked by Overlapping Not Sensitive Not Sensitive λ DNA (dam-/Hind III digest)
    XbaI RE-Mix®  recombinant timesaver 5min re-mix icon dam T/CTAGA - - - - - 65°C 37°C - Blocked by Overlapping Not Sensitive Not Sensitive
    XcmI  recombinant CCANNNNN/NNNNTGG NEBuffer 2.1 10 100 25 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    XhoI  recombinant timesaver 5min cpg C/TCGAG CutSmart™ Buffer 75 100 100 100 65°C 37°C Not Sensitive Not Sensitive Impaired λ DNA (HindIII digest)
    XhoI RE-Mix®  recombinant timesaver 5min re-mix icon cpg C/TCGAG - - - - - 80°C 37°C - Not Sensitive Not Sensitive Impaired
    XmaI  recombinant timesaver 5min cpg C/CCGGG CutSmart™ Buffer 25 50 10 100 65°C 37°C Not Sensitive Not Sensitive Impaired Adenovirus-2 DNA
    XmnI  recombinant timesaver 5min GAANN/NNTTC CutSmart™ Buffer 50 75 10 100 65°C 37°C Not Sensitive Not Sensitive Not Sensitive λ DNA
    ZraI  recombinant cpg GAC/GTC CutSmart™ Buffer 100 25 10 100 80°C 37°C Not Sensitive Not Sensitive Blocked λ DNA
    Ligation and Recutting Notes
    .
    .
    .
    .
    .

    Star Activity Notes
    .
    .
    .
    .
    Note: 
    1. The values listed in this table are approximate. They were obtained using each enzyme's specific unit assay substrate DNA.

    Toll Free: 1-800-387-1095

    Fax: 1-800-563-3789

    info.ca@neb.com

    Find us on facebook

    About NEB Web Discount Shipping Information Web Site Disclaimer NEB USA Cell Signaling Technology Sitemap
    Contents ¬©New England Biolabs Ltd.  New England Biolabs Ltd. is the exclusive Canadian distributor for Cell Signaling Technology, Inc.  New England Biolabs, Inc. is an ISO 9001 certified company.