pUC19 Vector

    Item# Description List Price Web Price Qty
    N3041L pUC19 Vector - 250 ug $376.00 $338.40 ADD TO CART
    N3041S pUC19 Vector - 50 ug $94.00 $84.60 ADD TO CART
    *On-line ordering is for Canadian customers only. Web pricing is applicable only to orders placed online at www.neb.ca
    X

    Companion Products

    Item# Description List Price Web Price Qty
    N3033L pBR322 Vector - 250 ug $376.00 $338.40 ADD TO CART
    N3033S pBR322 Vector - 50 ug $94.00 $84.60 ADD TO CART
    VIEW COMPANION PRODUCTS HIDE COMPANION PRODUCTS
    Categories:
    Cloning & Mutagenesis Products,
    DNA Plasmid Products

    Description

    pUC19 is a commonly used plasmid cloning vector in E.coli. The molecule is a small double-stranded circle, 2686 base pairs in length, and has a high copy number. pUC19 carries a 54 base-pair multiple cloning site polylinker that contains unique sites for 13 different hexanucleotide-specific restriction endonucleases (1).
    IMAGE WITH CAPTION
    Modify text and image as needed. In order for the modal to work, must update anchor href to point to updated image.

    DNASU and Addgene are central repositories for plasmid clones and collections that may also be helpful.

    Product Source

    pUC19 is isolated from E. coli ER2272 (dam+ dcm+ EcoK M-) by a standard plasmid purification procedure.

    Polylinker DNA Sequence

    GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT 

    GENBANK Assession Number

    L09137

    Properties and Usage

    General Utility

    Cloning

    Copy Number

    High (100+)

    Origin of Replication

    • pMB1 (high-copy mutant)

    Storage Temperature

    -20°C

    Storage Conditions

    10 mM Tris-HCl
    1 mM EDTA
    pH 8.0 @ 25°C

    References

    1. Yanisch-Perron, C., Vieira, J. and Messing, J. (1985). Gene. 33, 103-119.

    FAQs

    1. How homogeneous is the DNA/ how much is supercoiled?
    2. Are the plasmids cesium purified?
    3. What primers should I use to sequence an insert (pUC19, pNEB193, LITMUS)?

    Datacards

    The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.

    Certificate of Analysis

    The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality control's for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]

    Specifications

    The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]

    Safety Data Sheet

    The following is a list of Safety Data Sheet (SDS) that apply to this product to help you use it safely.
    • pUC19 Vector

    Datacards

    The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.