| Item# | Description | List Price | Web Price | Qty |
|---|
*On-line ordering is for Canadian customers only. Web pricing is applicable only to orders placed online at www.neb.ca
- Categories:
- Cloning & Mutagenesis Products,
- DNA Plasmid Products
pUC19 Vector
Description
pUC19 is a commonly used plasmid cloning vector in E.coli. The molecule is a small double-stranded circle, 2686 base pairs in length, and has a high copy number. pUC19 carries a 54 base-pair multiple cloning site polylinker that contains unique sites for 13 different hexanucleotide-specific restriction endonucleases (1).
Modify text and image as needed. In order for the modal to work, must update anchor href to point to updated image.
DNASU is a central repository for plasmid clones and collections that may also be helpful.
Product Source
pUC19 is isolated from E. coli ER2272 (dam+ dcm+ EcoK M-) by a standard plasmid purification procedure.Polylinker DNA Sequence
GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT
GENBANK Assession Number
L09137Properties and Usage
General Utility
CloningCopy Number
High (100+)Origin of Replication
- pMB1 (high-copy mutant)
Storage Temperature
-20°CStorage Conditions
10 mM Tris-HCl
1 mM EDTA
pH 8.0 @ 25°C
References
- Yanisch-Perron, C., Vieira, J. and Messing, J. (1985). Gene. 33, 103-119.
FAQs
Datacards
The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.
Material Safety Datasheets
The following is a list of Material Safety Data Sheets (MSDS) that apply to this product to help you use it safely. The following file naming structure is used to name these document files: [Product Name] MSDS. For international versions please contact us at info@neb.com.
Datacards
The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.
