| Item# | Description | List Price | Web Price | Qty |
|---|
*On-line ordering is for Canadian customers only. Web pricing is applicable only to orders placed online at www.neb.ca
- Categories:
- DNA Plasmids
pUC19 Vector
Description
pUC19 is a commonly used plasmid cloning vector in E.coli. The molecule is a small double-stranded circle, 2686 base pairs in length, and has a high copy number. pUC19 carries a 54 base-pair multiple cloning site polylinker that contains unique sites for 13 different hexanucleotide-specific restriction endonucleases (1).
DNASU and Addgene are central repositories for plasmid clones and collections that may also be helpful.
Product Source
pUC19 is isolated from E. coli ER2272 (dam+ dcm+ EcoK M-) by a standard plasmid purification procedure.Polylinker DNA Sequence
GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT
GENBANK Assession Number
L09137Properties and Usage
General Utility
CloningCopy Number
High (100+)Origin of Replication
- pMB1 (high-copy mutant)
Storage Temperature
-20°CStorage Conditions
10 mM Tris-HCl
1 mM EDTA
pH 8.0 @ 25°C
References
- Yanisch-Perron, C., Vieira, J. and Messing, J. (1985). Gene. 33, 103-119.
FAQs
Datacards
The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.
Certificate of Analysis
The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality control's for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]
Specifications
The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]
Safety Data Sheet
The following is a list of Safety Data Sheet (SDS) that apply to this product to help you use it safely.
Datacards
The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.
Legal and Disclaimers
This product is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB).While NEB develops and validates its products for various applications, the use of this product may require the buyer to obtain additional third party intellectual property rights for certain applications.
For more information about commercial rights, please contact NEB's Global Business Development team at gbd@neb.com.
This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.
