PI-PspI

Catalog # Concentration Size List Price Quantity Your Price
R0695S 5000 units/ml 500 units $115.00
$103.50
Catalog # Size List Price Your Price
R0695S 500 units $115.00
$103.50
Catalog #
Qty:
 
*On-line ordering is for Canadian customers only. Web pricing is applicable only to orders placed online at www.neb.ca
  • This is a homing endonuclease
  • Tolerates some sequence degeneracy within recognition sequence
  • Restriction Enzyme Cut Site: TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
Featured Videos
View Video Library
PI-PspI is obtained from a strain of E. coli which expresses the DNA polymerase from the extreme thermophile, Pyrococcus species GB-D (1). PI-PspI is a product of in vivo protein splicing that gives rise to both polymerase and endonuclease from a single polypeptide precursor.
Product Source
An E. coli strain that carries the PI-PspI gene from Pyrococcus species (H.W. Jannasch).
Reagents Supplied

The following reagents are supplied with this product:

NEB # Component Name Component # Stored at (°C) Amount Concentration
  PI-PspI R0695SVIAL -20 1 x 0.1 ml 5,000 units/ml
  Recombinant Albumin, Molecular Biology Grade B9200SVIAL -20 1 x 0.6 ml 20 mg/ml
  NEBuffer™ PI-PspI B0695SVIAL -20 1 x 1.5 ml 10 X
  pAKR7 XmnI-linearized Control Plasmid N0421SVIAL -20 1 x 0.01 ml 0.5 mg/ml

Properties & Usage

Unit Definition

One unit is defined as the amount of enzyme required to cleave 1 µg of pAKR7 XmnI-linearized Control Plasmid in 1 hour at 65°C in a total reaction volume of 50 µl.

Reaction Conditions

1X NEBuffer™ PI-PspI
Supplement with Recombinant Albumin, Molecular Biology Grade
Incubate at 65°C

1X NEBuffer™ PI-PspI
10 mM Tris-HCl
10 mM MgCl2
1 mM DTT
150 mM KCl
(pH 9.2 @ 25°C)

Activity in NEBuffers

NEBuffer™ r1.1: 10%
NEBuffer™ r2.1: 10%
NEBuffer™ r3.1: 10%
rCutSmart™ Buffer: 10%

Diluent Compatibility

Storage Buffer

10 mM Tris-HCl
300 mM NaCl
1 mM DTT
0.1 mM EDTA
500 µg/ml BSA
50% Glycerol
pH 7.4 @ 25°C

Heat Inactivation

No

Activity at Temperature

@37°C: 10%


Materials Sold Separately
Notes
  • Homing endonucleases do not have stringently-defined recognition sequences in the way that restriction enzymes do. That is, single base changes do not abolish cleavage but reduce its efficiency to variable extents. The precise boundary of required bases is generally not known. The recognition sequence listed is one site that is known to be recognized and cleaved.
  • Digests of DNA embedded in agarose should be performed with 1 unit of enzyme per µg of DNA for 3 hours at 50°C.
  • PI-PspI can remain bound to DNA after cutting and alter migration rate of DNA during electrophoresis. To disrupt binding, add SDS to a final concentration of 0.5% or purify DNA before electrophoresis.
  • Incubation at 37° results in 10% activity.
  • Supplied with plasmid DNA. XmnI-linearized  pAkR7 is supplied at 0.5 mg/ml in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA. Cleavage of this 3.7 kb plasmid gives fragments of 2146 and 1532 base pairs.  
  • For enzymes that cannot be heat-inactivated, we recommend using a column for cleanup (such as the Monarch® PCR & DNA Cleanup Kit), or running the reaction on an agarose gel and then extracting the DNA (we recommend Monarch Gel Extraction Kit), or performing a phenol/chloroform extraction.
  • Supplement with supplied vial of Recombinant Albumin (rAlbumin) to 100 µg/ml.
  • Note that this enzyme requires a 3-hour incubation time.
Tech Tips
  • PI-PspI (or PI-SceI or I-CeuI) can remain bound to DNA after cutting and alter migration rate of DNA during electrophoresis.
    To disrupt binding, add SDS to a final concentration of 0.5% or purify DNA before electrophoresis.
Quality Control Assay
Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.
Specifications
The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]
Certificate of Analysis
The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality controls for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]
Legal And Disclaimer

Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.

This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.

New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.

Top