New England Biolabs Canada
Expand menu
Sign In or Sign UpMy NEB
1

I-CeuI

Catalog # Concentration Size List Price Quantity Your Price
R0699L 5000 units/ml 2500 units $497.00
$447.30
R0699S 5000 units/ml 500 units $120.00
$108.00
Catalog # Size List Price Your Price
R0699L 2500 units $497.00
$447.30
R0699S 500 units $120.00
$108.00
Catalog #
Qty:
 
*On-line ordering is for Canadian customers only. Web pricing is applicable only to orders placed online at www.neb.ca
  • 100% activity in rCutSmart™ Buffer (over 210 enzymes are available in the same buffer) allowing for easier double digests
  • This is a homing endonuclease and requires 3 hour incubation periods
  • Tolerates some sequence degeneracy within recognition sequence
  • Restriction Enzyme Cut Site: TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
Featured Videos
View Video Library
  • Monarch_MiniprepProtocol_VideoThumb
    Reduce Star Activity with High-Fidelity Restriction Enzymes
  • Monarch_MiniprepProtocol_VideoThumb
    Standard Protocol for Restriction Enzyme Digests
  • Monarch_MiniprepProtocol_VideoThumb
    NEB® TV Ep. 15 – Applications of Restriction Enzymes
  • Monarch_MiniprepProtocol_VideoThumb
    Restriction Enzyme Digest Protocol: Cutting Close to DNA End
  • Monarch_MiniprepProtocol_VideoThumb
    Restriction Enzyme Digestion Problem: DNA Smear on Agarose Gel
  • Monarch_MiniprepProtocol_VideoThumb
    Why is My Restriction Enzyme Not Cutting DNA?
  • Monarch_MiniprepProtocol_VideoThumb
    Restriction Enzyme Digest Problem: Too Many DNA Bands
  • Monarch_MiniprepProtocol_VideoThumb
    Double Digestion with NEBcloner
The intron encoding I-CeuI is present in the chloroplast large rRNA gene of Chlamydomonas eugametos (1). This gene has been cloned and overexpressed in E. coli (2).
Product Source
An E. coli strain that carries the I-CeuI gene from Chlamydomonas eugametos (C. Lemieux).
Reagents Supplied

The following reagents are supplied with this product:

NEB # Component Name Component # Stored at (°C) Amount Concentration
  I-CeuI R0699SVIAL -20 1 x 0.1 ml 5,000 units/ml
  rCutSmart™ Buffer B6004SVIAL -20 1 x 1.25 ml 10 X
  pBHS ScaI-linearized Control Plasmid N0423SVIAL -20 1 x 0.01 ml 0.5 mg/ml
  I-CeuI R0699LVIAL -20 1 x 0.5 ml 5,000 units/ml
  rCutSmart™ Buffer B6004SVIAL -20 1 x 1.25 ml 10 X
  pBHS ScaI-linearized Control Plasmid N0423SVIAL -20 1 x 0.01 ml 0.5 mg/ml

Properties & Usage

Unit Definition

One unit is defined as the amount of enzyme required to cleave 1 µg of pBHS ScaI-linearized Control Plasmid in 3 hours at 37°C in a total reaction volume of 50 µl.

Reaction Conditions

1X rCutSmart™ Buffer
Incubate at 37°C

1X rCutSmart™ Buffer
50 mM Potassium Acetate
20 mM Tris-acetate
10 mM Magnesium Acetate
100 µg/ml Recombinant Albumin
(pH 7.9 @ 25°C)

Activity in NEBuffers

NEBuffer™ r1.1: 10%
NEBuffer™ r2.1: 10%
NEBuffer™ r3.1: 10%
rCutSmart™ Buffer: 100%

Diluent Compatibility

Storage Buffer

10 mM Tris-HCl
300 mM NaCl
1 mM DTT
0.1 mM EDTA
500 µg/ml BSA
50% Glycerol
pH 7.4 @ 25°C

Heat Inactivation

65°C for 20 minutes

Companion Products
Materials Sold Separately
Notes
  • I-CeuI can remain bound to DNA after cutting and alter migration rate of DNA during electrophoresis. To disrupt binding, add SDS to a final concentration of 0.5% or purify DNA before electrophoresis.
  • Homing endonucleases do not have stringently-defined recognition sequences in the way that restriction enzymes do. That is, single base changes do not abolish cleavage but reduce its efficiency to variable extents. The precise boundary of required bases is generally not known. The recognition sequence listed is one site that is known to be recognized and cleaved.
  • Supplied with plasmid DNA. ScaI-linearized pBHS is supplied at 0.5 mg/ml in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA. Cleavage of this 3.5 kb plasmid gives fragments of 2100 and 1400 base pairs.
  • Note that this enzyme requires a 3-hour incubation time.
Quality Control Assay
Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.
Specifications
The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]
Certificate of Analysis
The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality controls for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]
Safety Data Sheets
Legal And Disclaimer

Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.

This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.

New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.

Other Products You May Be Interested In
 Top