The following sequencing primers can be used (not available from New England Biolabs): malE primer on the 5′ side of the insert and the pMAL reverse primer for sequencing from the 3′ side.

 Forward Primer (24-mer, upstream of MCS)

 5′d(GGTCGTCAGACTGTCGATGAAGCC)3′

 Reverse Primer (24-mer, downstream of MCS)

 5′d(TGTCCTACTCAGGAGAGCGTTCAC)3′

The sequences of the pMAL vectors are also available at www.neb.com. PCR of inserts cloned into the MCS can be performed using the same primer pair.