Control LAMP Primer Mix (rActin)

Catalog #	Concentration	Size	List Price	Quantity	Your Price
S0164S	10 X	50 reactions	$152.00		$136.80

Catalog #	Size	List Price	Your Price
S0164S	50 reactions	$152.00	$136.80

The Control LAMP Primer Mix (rActin) targets actin RNA at an exon-exon junction. It is a primer set (F3, B3, FIP, BIP, LF, LB) that amplifies rActin and can be used to confirm the activity of reagents, proper sample handling and the presence of human nucleic acid template in a LAMP reaction.

This product serves as an internal control primer set in the SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (NEB #E2019).

Control LAMP Primer Sequences: rActin (5´→ 3´)

rActin Primer Set	Sequence
ACTB-F3	AGTACCCCATCGAGCACG
ACTB-B3	AGCCTGGATAGCAACGTACA
ACTB-FIP	GAGCCACACGCAGCTCATTGTATCACCAACTGGGACGACA
ACTB-BIP	CTGAACCCCAAGGCCAACCGGCTGGGGTGTTGAAGGTC
ACTB-LF	TGTGGTGCCAGATTTTCTCCA
ACTB-LB	CGAGAAGATGACCCAGATCATGT

Reagents Supplied

The following reagents are supplied with this product:

NEB #

Component Name

Component #

Stored at (°C)

Amount

Concentration

S0164S -20

	Control LAMP Primer Mix (rActin)	S0164AVIAL	-20	1 x 0.14 ml	10 X

Features

Optimized mixture of 2 primer sets for enhanced speed and sensitivity of SARS-CoV-2 viral RNA detection
Information on using this product to detect SARS-CoV-2 viral RNA using WarmStart LAMP reagents with UDG can be viewed here
View the protocol for recommended reaction setup

An exception occurred during the operation, making the result invalid. Check InnerException for exception details.

Protocols

Overview of Reaction Setup (NEB #S0164)

FAQs

Quality Control Assay

Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.

Specifications

The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]

Certificate of Analysis

The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality controls for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]

Safety Data Sheets

Control LAMP Primer Mix (rActin)

Legal And Disclaimer

Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.

This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.

New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.